Quick Order

Text Size:AAA

Human EEF1E1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EEF1E1cDNA Clone Product Information
cDNA Size:525
cDNA Description:ORF Clone of Homo sapiens eukaryotic translation elongation factor 1 epsilon 1 DNA.
Gene Synonym:P18, AIMP3, EEF1E1
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

EEF1E1, also known as AIMP3 and p18, is a multifunctional protein that localizes to both the cytoplasm and nucleus. In the cytoplasm, EEF1E1 is an auxiliary component of the macromolecular aminoacyl-tRNA synthase complex. It is comprised of a bifunctional glutamyl-prolyl-tRNA synthase, the monospecific isoleucyl, leucyl, glutaminyl, methionyl, lysyl, arginyl and aspartyl-tRNA synthases, and three auxiliary proteins, EEF1E1/p18, AIMP2/p38 and AIMP1/p43. EEF1E1 also plays a positive role in ATM/ATR-mediated p53 activation.

  • Mao M. et al., 1998, Proc Natl Acad Sci. 95 (14): 8175-80.
  • Quevillon S. et al., 1999, J Mol Biol. 285 (1): 183-95.
  • Ahn HC. et al., 2003, FEBS Lett. 542 (1-3): 119-24.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items