Quick Order

Human ALDH1L2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ALDH1L2 cDNA Clone Product Information
Gene_bank_ref_id:BC103935
RefSeq ORF Size:1467bp
cDNA Description:Full length Clone DNA of Homo sapiens aldehyde dehydrogenase 1 family, member L2.
Gene Synonym:DKFZp686A16126, DKFZp686M064, DKFZp686P14145, FLJ36769, FLJ38508, MGC119536, MGC119537, mtFDH, ALDH1L2
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG13978-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"