After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PLAC9 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PLAC9 cDNA Clone Product Information
Gene_bank_ref_id:NM_001012973.1
RefSeq ORF Size:294bp
cDNA Description:Full length Clone DNA of Homo sapiens placenta-specific 9.
Gene Synonym:PLAC9
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

PLAC9 belongs to the PLAC9 family. PLAC9 gene is a placental-enriched gene. There are other two placental-enriched genes: Plac1 and Plac8. Plac1 is strongly expressed in all trophoblast-derived cells in the placenta and has been described in 2000. Plac8 expression is restricted to the spongiotrophoblast layer during development, whereas PLAC9 is weakly expressed though highly enriched in placenta. For both, cDNAs with complete open reading frames were recovered and exon-intron structures inferred from comparisons of mouse cDNA and genomic sequence. The predicted proteins both contain putative signal peptides, with a coiled-coil segment of mPLAC9 as the only other detected motif. Genomic sequence comparisons reveal that in addition to an apparent pseudogene on chromosome 1, Plac8 is expressed at mouse cytoband 5e3.

References
  • Deloukas P. et al., 2004, Nature. 429 (6990): 375-81.
  • Galaviz-Hernandez C. et al., 2003, Gene. 309 (2): 81-9.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Size / Price
    Catalog: HG13971-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"