After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SEZ6L2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SEZ6L2cDNA Clone Product Information
cDNA Size:2430
cDNA Description:ORF Clone of Homo sapiens seizure related 6 homolog (mouse)-like 2 DNA.
Gene Synonym:PSK-1
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

SEZ6L2, also known as PSK-1, belongs to the SEZ6 family. It contains 3 CUB domains and 5 Sushi (CCP/SCR) domains. SEZ6L2 may contribute to specialized endoplasmic reticulum functions in neurons.SEZ6L2 presents on the surface of lung-cancer cells. SEZ6L2 should be a useful prognostic marker of lung cancers. Increased expression of this gene has been found in lung cancers, and the protein is therefore considered to be a novel prognostic marker for lung cancer.

  • Bedoyan JK. et al., 2010, Am J Med Genet A. 152A (6): 1567-74.
  • Konyukh M. et al., 2011, PLoS One. 6 (3): e17289.
  • Wang J. et al., 2011, Mol Syst Biol. 7: 536.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 Business days
      Recently Viewed Items