Quick Order

Human B3GNT6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
B3GNT6cDNA Clone Product Information
Gene_bank_ref_id:NM_138706.3
cDNA Size:1155
cDNA Description:ORF Clone of Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase) DNA.
Gene Synonym:B3Gn-T6, IMAGE:4907098
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

B3GNT6 belongs to the glycosyltransferase 31 family. B3GNT6 play s an important role in the synthesis of mucin-type O-glycans in digestive organs. It catalyzes the transfer of GlcNAc from UDP-GlcNAc to GalNAcalpha1-Ser/Thr (Tn antigen) to form the core 3 structure (GlcNAcbeta1-3GalNAcalpha1-Ser/Thr). Core 3 structure exists in O-glycan which is an important precursor in the biosynthesis of mucin-type glycoproteins. Loss of core 3 could lead to the production of secreted mucins, then bacteria would be inefficiently cleared from the system, and chronic inflammation would be developed, which eventually would result in development of cancer. B3GNT6 gene is a tumor suppressor gene.

References
  • Hennet T, et al. (1998) Genomic cloning and expression of three murine UDP-galactose: beta-N-acetylglucosamine beta1,3-galactosyltransferase genes. J Biol Chem. 273(1):58-65.
  • Kolbinger F, et al. (1998) Cloning of a human UDP-galactose:2-acetamido-2-deoxy-D-glucose 3beta-galactosyltransferase catalyzing the formation of type 1 chains. J Biol Chem. 273(1): 433-40.
  • Henrissat B, et al. (1997) A classification of nucleotide-diphospho-sugar glycosyltransferases based on amino acid sequence similarities. Biochem J. 326:929-39.
  • Size / Price
    Catalog:HG13951-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"