After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PLBD2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PLBD2 cDNA Clone Product Information
Gene_bank_ref_id:NM_173542.3
RefSeq ORF Size:1770bp
cDNA Description:Full length Clone DNA of Homo sapiens phospholipase B domain containing 2.
Gene Synonym:P76
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

PLBD2 localizes to the lysosome, as its absence could plausibly lead to a serious yet unrecognized lysosomal storage disease. PLBD1 and PLBD2 are semi-orphans in the sense of being probable phospholipases of B class but with uncertain physiological substrates and thus functionalities. PLBD1 and PLBD2 constitute a small gene family (sequence homology class) within vertebrates though one that occurs expanded in some early diverging eukaryotes. PLBD2 presents a special difficulty in that a sequence of post-translational steps are apparently necessary for its activation. Without these, potential substrates can hardly be assayed. These steps include removal of the signal peptide, mannosylation appropriate to the lysosome targeting receptor, and self-catalytic proteolytic activation to expose the substrate binding site as this becomes appropriate.

References
  • Morgan CP. et al., 2004), Biochem J. 382 (2): 441-9.
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Havugimana PC. et al., 2012. Cell. 150 (5): 1068-81.
  • Size / Price
    Catalog: HG13947-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"