After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human MATN4 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MATN4 cDNA Clone Product Information
NCBI RefSeq:BC141811
RefSeq ORF Size:1623bp
cDNA Description:Full length Clone DNA of Homo sapiens matrilin 4.
Gene Synonym:HE6WCR54
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-MATN4
Restriction Site:KpnI + XbaI (6.1kb+1.62kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human MATN4 Gene Plasmid Map
Human MATN4 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: HG13946-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"