After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human GBP2 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human GBP2 cDNA Clone Product Information
NCBI RefSeq:BC073163
RefSeq ORF Size:1776bp
cDNA Description:Full length Clone DNA of Homo sapiens guanylate binding protein 2, interferon-inducible.
Gene Synonym:DKFZp451C2311, GBP2
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

GBP-2 belongs to the guanylate-binding protein (GBP) family. GBPs are characterized by their ability to specifically bind guanine nucleotides (GMP, GDP, and GTP). As GTPases induced by IFN-gamma (Interferon-inducible GTPase), they are key to the protective immunity against microbial and viral pathogens. GBP-2 is a GTPase that converts GTP to GDP and GMP. It binds GTP, GDP and GMP. GBP-2 hydrolyzes GTP very efficiently. GDP rather than GMP is the major reaction product. GBP-2 is induced by interferons that have antiviral effects and inhibit tumor cell proliferation.

References
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Wistow G, et al. (2002) Expressed sequence tag analysis of human RPE/choroid for the NEIBank Project: over 6000 non-redundant transcripts, novel genes and splice variants. Mol Vis. 8:205-20.
  • Neun R, et al. (1996) GTPase properties of the interferon-induced human guanylate-binding protein 2. FEBS Lett. 390(1):69-72.
  • Size / Price
    Catalog: HG13930-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"