Quick Order

Text Size:AAA

Human GBP2 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human GBP2 cDNA Clone Product Information
NCBI RefSeq:BC073163
RefSeq ORF Size:1776bp
cDNA Description:Full length Clone DNA of Homo sapiens guanylate binding protein 2, interferon-inducible.
Gene Synonym:DKFZp451C2311, GBP2
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

GBP-2 belongs to the guanylate-binding protein (GBP) family. GBPs are characterized by their ability to specifically bind guanine nucleotides (GMP, GDP, and GTP). As GTPases induced by IFN-gamma (Interferon-inducible GTPase), they are key to the protective immunity against microbial and viral pathogens. GBP-2 is a GTPase that converts GTP to GDP and GMP. It binds GTP, GDP and GMP. GBP-2 hydrolyzes GTP very efficiently. GDP rather than GMP is the major reaction product. GBP-2 is induced by interferons that have antiviral effects and inhibit tumor cell proliferation.

References
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Wistow G, et al. (2002) Expressed sequence tag analysis of human RPE/choroid for the NEIBank Project: over 6000 non-redundant transcripts, novel genes and splice variants. Mol Vis. 8:205-20.
  • Neun R, et al. (1996) GTPase properties of the interferon-induced human guanylate-binding protein 2. FEBS Lett. 390(1):69-72.
  • Size / Price
    Catalog: HG13930-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"