Quick Order

Human EPHB3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EPHB3cDNA Clone Product Information
cDNA Size:2997
cDNA Description:ORF Clone of Homo sapiens EPH receptor B3 DNA.
Gene Synonym:ETK2, HEK2, TYRO6
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Ephrin & Eph Receptor Related Products
Product nameProduct name
Cynomolgus EphB1 / EPHT2 Protein (His Tag)Human EphA1 / Eph Receptor A1 Protein (His Tag, ECD)Rat EphB3 / HEK2 / Eph Receptor B3 Protein (His Tag, ECD)Mouse Ephrin B3 / EFNB3 Protein (His Tag)Mouse EphB6 Protein (His Tag)Human Ephrin-A3 / EFNA3 / EFL2 Protein (Fc Tag)Human Ephrin-A3 / EFNA3 Protein (His & Fc Tag)Human Ephrin-A3 / EFNA3 Protein (His Tag)Human Ephrin-A3 / EFNA3 ProteinHuman Ephrin-A5 / EFNA5 Protein (Fc Tag)Human Ephrin-A5 / EFNA5 Protein (His Tag)Human EphB6 / EphB6 Protein (Fc Tag)Human EphB6 / EphB6 Protein (His Tag)Human EphB6 / EphB6 ProteinHuman EphB4 / HTK Protein (Fc Tag)Human EphB4 / HTK Protein (His Tag)Human EphB4 / HTK Protein (aa 563-987, His & GST Tag)Human EphB4 / HTK ProteinHuman EphA1 / Eph Receptor A1 Protein (Fc Tag)Mouse Ephrin B3 / EFNB3 Protein (ECD, Fc Tag)Human EphB2 Protein (His & Fc Tag)Human EphB2 Protein (His Tag)Human EphB2 / Hek5 Protein (aa 570-987, His & GST Tag)Human EphB2 / Hek5 ProteinHuman Ephrin-B2 / EFNB2 Protein (His & Fc Tag)Human Ephrin-B2 / EFNB2 Protein (His Tag)Human Ephrin-B2 / EFNB2 ProteinHuman Ephrin-A1 / EFNA1 Protein (His & Fc Tag)Human Ephrin-A1 / EFNA1 Protein (His Tag)Human Ephrin-B1 / EFNB1 Protein (His & Fc Tag)Human Ephrin-B1 / EFNB1 Protein (His Tag)Human Ephrin-A4 / EFNA4 Protein (Fc Tag)Human EphA4 Protein (His & Fc Tag)Human EphA4 Protein (His Tag)Human EphA4 / HEK8 Protein (aa 570-986, His & GST Tag)Human EphA7 / EHK3 Protein (His Tag)Human EphA7 / EHK3 Protein (His & GST Tag)Human EphB1 / EPHT2 Protein (His Tag)Human EphB1 / EPHT2 Protein (aa 565-984, His & GST Tag)Human EphB3 / HEK2 Protein (aa 585-998, His & GST Tag)Human EphA2 Protein (His Tag)Human EphA2 Protein (aa 585-976, His & GST Tag)Mouse EphB1 / EPHT2 Protein (His Tag)Mouse EphB1 / EPHT2 Protein (His & GST Tag)Mouse EphA4 / HEK8 Protein (Fc Tag)Mouse EphA4 / HEK8 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 ProteinMouse Ephrin-B1 / EFNB1 Protein (Fc Tag)Mouse Ephrin-B1 / EFNB1 Protein (His Tag)Mouse EphB3 / HEK2 Protein (His Tag)Mouse EphB4 / HTK Protein (Fc Tag)Mouse EphB4 / HTK Protein (His Tag)Mouse EphA2 Protein (His Tag)Mouse EphA7 / EHK-3 Protein (His Tag)Mouse Ephrin-A1 / EFNA1 Protein (Fc Tag)Mouse Ephrin-A1 / EFNA1 Protein (His Tag)Mouse Ephrin-A3 / EFNA3 Protein (His Tag)Mouse Ephrin-A4 / EFNA4 Protein (Fc Tag)Mouse Ephrin-A4 / EFNA4 Protein (His Tag)Mouse Ephrin-A5 / EFNA5 Protein (Fc Tag)Mouse Ephrin-A5 / EFNA5 Protein (His Tag)Mouse Ephrin-B2 / EFNB2 Protein (Fc Tag)Mouse Ephrin-B2 / EFNB2 Protein (His Tag)Mouse EphA6 / EHK-2 Protein (Fc Tag)Mouse EphA6 / EHK-2 Protein (His Tag)Mouse EphB2 / Hek5 Protein (Fc Tag)Mouse EphA1 / EPH receptor A1 Protein (His Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (Fc Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (His Tag)Canine Ephrin-A5 / EFNA5 Protein (Fc Tag)Canine Ephrin-B2 / EFNB2 Protein (His Tag)Rat Ephrin-A5 / EFNA5 Protein (Fc Tag)Rat Ephrin-A5 / EFNA5 Protein (His Tag)Rat Ephrin-B1 / EFNB1 Protein (Fc Tag)Rat Ephrin-B1 / EFNB1 Protein (His Tag)Rat Ephrin-B2 / EFNB2 Protein (Fc Tag)Rat Ephrin-B2 / EFNB2 Protein (His Tag)Rat EphA7 / EHK3 Protein (His Tag)Rat Ephrin-B3 / EFNB3 Protein (Fc Tag)Rat Ephrin-B3 / EFNB3 Protein (His Tag)Rat Ephrin-A1 / EFNA1 Protein (His Tag)Rat EphA4 Protein (Fc Tag) Rat EphA4 Protein (His Tag)Cynomolgus EphA4 Protein (Fc Tag)Cynomolgus EphA4 Protein (His Tag)Cynomolgus Ephrin-A5 / EFNA5 Protein (Fc Tag)Cynomolgus Ephrin-A5 / EFNA5 Protein (His Tag)Cynomolgus EphB6 / EphB6 Protein (Fc Tag)Mouse EphB2 / Hek5 Protein (His Tag)Cynomolgus EphB1 / EPHT2 Protein (Fc Tag)Canine Ephrin-B2 / EFNB2 Protein (Fc Tag)

Ephrin type-B receptor 3, also known as EphB3 or HEK2, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family which 16 known receptors (14 found in mammals) are involved: EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA10, EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6. The Eph family of receptor tyrosine kinases (comprising EphA and EphB receptors) has been implicated in synapse formation and the regulation of synaptic function and plasticity6. Ephrin receptors are components of cell signalling pathways involved in animal growth and development, forming the largest sub-family of receptor tyrosine kinases (RTKs). Ligand-mediated activation of Ephs induce various important downstream effects and Eph receptors have been studied for their potential roles in the development of cancer. EphB receptor tyrosine kinases are enriched at synapses, suggesting that these receptors play a role in synapse formation or function. We find that EphrinB binding to EphB induces a direct interaction of EphB with NMDA-type glutamate receptors. This interaction occurs at the cell surface and is mediated by the extracellular regions of the two receptors, but does not require the kinase activity of EphB.

  • Bergemann AD, et al. (1998) Ephrin-B3, a ligand for the receptor EphB3, expressed at the midline of the developing neural tube. Oncogene. 16(4): 471-80.
  • Hock B, et al. (1998) PDZ-domain-mediated interaction of the Eph-related receptor tyrosine kinase EphB3 and the ras-binding protein AF6 depends on the kinase activity of the receptor. Proc Natl Acad Sci U S A. 95(17): 9779-84.
  • Liu X, et al. (2006) EphB3: an endogenous mediator of adult axonal plasticity and regrowth after CNS injury. J Neurosci. 26(12): 3087-101.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items