Quick Order

Text Size:AAA

Human PARVA natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PARVA cDNA Clone Product Information
NCBI RefSeq:BC016713
RefSeq ORF Size:1119bp
cDNA Description:Full length Clone DNA of Homo sapiens parvin, alpha.
Gene Synonym:MXRA2, CH-ILKBP
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Actopaxin, also known as alpha-parvin, belongs to the parvin family. It is widely expressed, with highest levels in heart, skeletal muscle, kidney and liver. Actopaxin contains 2 CH (calponin-homology) domains and probably plays a role in the regulation of cell adhesion and cytoskeleton organization. It interacts with integrin-linked protein kinase and probably with actin and the LD1 and LD4 motifs of PXN. Actopaxin binds directly to both F-actin and paxillin LD1 and LD4 motifs. Actopaxin also exhibits robust focal adhesion localization in several cultured cell types but is not found along the length of the associated actin-rich stress fibers. It is absent from actin-rich cell-cell adherens junctions.

References
  • Korenbaum E, et al. (2002) Genomic organization and expression profile of the parvin family of focal adhesion proteins in mice and humans. Gene. 279(1):69-79.
  • Nikolopoulos SN, et al. (2002) Molecular dissection of actopaxin-integrin-linked kinase-Paxillin interactions and their role in subcellular localization. J Biol Chem. 277(2): 1568-75.
  • Tu Y, et al. (2001) A new focal adhesion protein that interacts with integrin-linked kinase and regulates cell adhesion and spreading. J Cell Biol. 153(3): 585-98.
  • Size / Price
    Catalog: HG13919-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"