Quick Order

Text Size:AAA

Human TBCA natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TBCA cDNA Clone Product Information
Gene_bank_ref_id:BC018210
RefSeq ORF Size:327bp
cDNA Description:Full length Clone DNA of Homo sapiens tubulin folding cofactor A.
Gene Synonym:TBCA
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Tubulin folding cofactor A belongs to the TBCA family. It is one of four proteins (cofactors A, D, E, and C) involved in the early step of the tubulin folding pathway. These proteins can fold intermediates and finally lead to correctly folded beta-tubulin. It is believed that tubulin folding cofactors A and D play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Tubulin folding cofactor E binds to the cofactor D/beta-tubulin complex; interaction with tubulin folding cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state.

References
  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Irwin DM, et al. (2003) Molecular evolution of vertebrate goose-type lysozyme genes. J Mol Evol. 56(2):234-42.
  • Sklar P, et al. (2011) Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. Nat Genet. 43(10):977-83.
  • Size / Price
    Catalog: HG13918-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"