After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ABHD14B natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ABHD14B cDNA Clone Product Information
Gene_bank_ref_id:BC007234
RefSeq ORF Size:633bp
cDNA Description:Full length Clone DNA of Homo sapiens abhydrolase domain containing 14B.
Gene Synonym:CIB
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

ABHD14B belongs to the AB hydrolase superfamily, ABHD14 family. It can be detected in spleen, thymus, prostate, testis, ovary, small intestine, colon, peripheral blood leukocyte, heart, placenta, lung, liver, skeletal muscle, pancreas and kidney. ABHD14B has hydrolase activity towards p-nitrophenyl butyrate (in vitro) and may interact with TAF1. It may activate transcription. Recombinant human ABHD14B protein, fused to His-tag at N-terminus, was expressed in E.coli and purified by using conventional chromatography techniques. ABHD14B contains an alpha/beta hydrolase fold, which is a catalytic domain found in a very wide range of enzymes. In molecular biology, the alpha/beta hydrolase fold is common to a number of hydrolytic enzymes of widely differing phylogenetic origin and catalytic function. The Ab hydrolase domain containing gene subfamily is comprised of 15 mostly uncharacterized members.

References
  • Mehrle A, et al. (2006) The LIFEdb database in 2006. Nucleic Acids Res. 34:D415-8.
  • Wan D, et al. (2004) Large-scale cDNA transfection screening for genes related to cancer development and progression. Proc Natl Acad Sci. 101(44):15724-9.
  • Wiemann S, et al. (2004) From ORFeome to biology: a functional genomics pipeline. Genome Res. 14 (10B):2136-44.
  • Size / Price
    Catalog: HG13913-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"