After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human DYDC2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DYDC2cDNA Clone Product Information
cDNA Size:534
cDNA Description:ORF Clone of Homo sapiens DPY30 domain containing 2 DNA.
Gene Synonym:DYDC2
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

DPY30 domain containing 2 belongs to the dpy-30 family. Dumpy-30 family members act as determinants of male fertility and interaction partners of metal-responsive transcription factor 1 (MTF-1) in Drosophila. MTF-1 plays a key role in transition metal detoxification and homeostasis. It binds to metal response elements (MREs). Two candidate dMTF-1 interactors are related to the small regulatory protein Dumpy-30 (Dpy-30) of the worm C. elegans. Dpy-30 is the founding member of a protein family involved in chromatin modifications, notably histone methylation. Mutants affect mating type in yeast and male mating in C. elegans. As part of the MLL1/MLL complex, DPY30 domain containing 2 is involved in methylation and dimethylation at 'Lys-4' of histone H3. H3 'Lys-4' methylation represents a specific tag for epigenetic transcriptional activation. DPY30 domain containing 2 may also play an indirect or direct role in endosomal transport.

  • 1. Deloukas P, et al. (2004) The DNA sequence and comparative analysis of human chromosome 10. Nature. 429(6990):375-81.
  • 2. Rual JF, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • 3. Xin X, et al. (2009) Shifted Transversal Design smart-pooling for high coverage interactome mapping. Genome Res. 19(7):1262-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items