After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CABP5 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CABP5 cDNA Clone Product Information
Gene_bank_ref_id:BC126133
RefSeq ORF Size:522bp
cDNA Description:Full length Clone DNA of Homo sapiens calcium binding protein 5.
Gene Synonym:CABP3, CABP5
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CABP3, also known as CABP5, belongs to a subfamily of calcium binding proteins, which share similarity to calmodulin. Calcium binding proteins are an important component of calcium mediated cellular signal transduction. Expression of CABP3 gene is retina-specific. The mouse homolog of CABP3 has been shown to express in the inner nuclear layer of the retina, suggested its role in neuronal functioning. The specific function of CABP3 gene is unknown. Study of the transcripts and genomic structure revealed that the 5 end of this gene is complementary and reverse to that of the CABP5 gene, and the sequence beyond the overlapping region is nearly identical to that of CABP5. Thus, these two genes encode the protein products with distinct N-terminal halves but identical C-terminal halves. CABP3 inhibits calcium-dependent inactivation of L-type calcium channel and shifts voltage dependence of activation to more depolarized membrane potentials. It is also involved in the transmission of light signals.

References
  • McCauliffe DP, et al. (1990) A human Ro/SS-A autoantigen is the homologue of calreticulin and is highly homologous with onchocercal RAL-1 antigen and an aplysia memory molecule. J Clin Invest. 86(1):332-5.
  • Beutler E, et al. (1997) HLA-H and associated proteins in patients with hemochromatosis. Mol Med. 3(6):397-402.
  • Michalak M, et al. (2002) Calreticulin in cardiac development and pathology. Biochim Biophys Acta. 1600(1-2):32-7.
  • Size / Price
    Catalog: HG13896-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"