After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GPHA2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GPHA2 cDNA Clone Product Information
Gene_bank_ref_id:NM_130769.3
RefSeq ORF Size:390bp
cDNA Description:Full length Clone DNA of Homo sapiens glycoprotein hormone alpha 2.
Gene Synonym:A2, GPA2, ZSIG51, GPHA2
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

GPHA2 is a member of the glycoprotein hormones subunit alpha family. Glycoprotein hormones consist of two subunits, the common alpha- and specific beta-subunits, which associate noncovalently to form a heterodimer. The alpha-subunit combines with four distinct beta-subunits giving rise to four biologically active hormones in human: FSH, LH, TSH, and CG. GPHA2 and glycoprotein hormone beta 5 (GPHB5) can form a noncovalent heterodimer. GPHA2 can be detected in a variety of tissues. Recombinant A2/B5 heterodimeric glycoproteins activates human TSH receptors, but not LH and FSH receptors, and shows high affinity to TSH receptors in a radioligand receptor assay. The heterodimer also stimulates cAMP production and thymidine incorporation by cultured thyroid cells and increases serum thyroxine levels in TSH-suppressed rats in vivo. This new heterodimeric glycoprotein hormone was named as thyrostimulin based on its thyroid-stimulating activity. The expression of thyrostimulin in the anterior pituitary known to express TSH receptors suggested a paracrine mechanism.

References
  • Hsu SY. et al., 2002, Science. 295 (5555): 671-4.
  • Suzuki C. et al., 2007, Regul Pept. 142 (1-2): 60-7.
  • Breous E. et al., 2006, Mol Cell Endocrinol. 245 (1-2): 169-80.
  • Size / Price
    Catalog: HG13894-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"