Quick Order

Human RFK natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RFK cDNA Clone Product Information
NCBI RefSeq:BC007069.1
RefSeq ORF Size:489bp
cDNA Description:Full length Clone DNA of Homo sapiens riboflavin kinase.
Gene Synonym:RIFK, RP11-422N19.2
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Flavokinase is a member of the transferases family, specifically those transferring phosphorus-containing groups (phosphotransferases) with an alcohol group as acceptor. Flavokinase is an essential enzyme that catalyzes the phosphorylation of riboflavin (vitamin B2) to form flavin mononucleotide (FMN), an obligatory step in vitamin B2 utilization and flavin cofactor synthesis. It has been proposed that TNF, through the activation of the flavokinase gene, enhances the incorporation of FAD in NADPH oxidase enzymes, which is a critical step for the assembly and activation of NADPH oxidase.

References
  • Hirano G, et al. (2011) Involvement of riboflavin kinase expression in cellular sensitivity against cisplatin. Int J Oncol. 38(4):893-902.
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Size / Price
    Catalog: HG13881-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"