Quick Order

Human UBASH3B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
UBASH3BcDNA Clone Product Information
cDNA Size:1950
cDNA Description:ORF Clone of Homo sapiens ubiquitin associated and SH3 domain containing, B DNA.
Gene Synonym:KIAA1959, MGC15437, STS-1, STS1, TULA-2, p70, UBASH3B
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human UBASH3B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name

UBASH3B contains a ubiquitin associated domain at the N-terminus, an SH3 domain, and a C-terminal domain with similarities to the catalytic motif of phosphoglycerate mutase. UBASH3B was found to inhibit endocytosis of epidermal growth factor receptor (EGFR) and platelet-derived growth factor receptor. UBASH3B interferes with CBL-mediated down-regulation and degradation of receptor-type tyrosine kinases. It promotes accumulation of activated target receptors, such as T-cell receptors and EGFR, on the cell surface. UBASH3B exhibits tyrosine phosphatase activity toward several substrates including EGFR, FAK, SYK, and ZAP70. Down-regulates proteins that are dually modified by both protein tyrosine phosphorylation and ubiquitination.

  • Maruyama K, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138(1-2):171-4.
  • Carpino N, et al. (2002) Identification, cDNA cloning, and targeted deletion of p70, a novel, ubiquitously expressed SH3 domain-containing protein. Mol Cell Biol. 22(21):7491-500.
  • Nagase T, et al. (2002) Prediction of the coding sequences of unidentified human genes. XXII. The complete sequences of 50 new cDNA clones which code for large proteins. DNA Res. 8(6):319-27.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items