Quick Order

Human EIF4B natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human EIF4B cDNA Clone Product Information
Gene_bank_ref_id:BC073139
RefSeq ORF Size:1836bp
cDNA Description:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 4B.
Gene Synonym:EIF-4B, PRO1843, EIF4B
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-EIF4B
Restriction Site:KpnI + NotI (6.1kb + 1.84kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG13867-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"