Quick Order

Human UBASH3A natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human UBASH3A cDNA Clone Product Information
Gene_bank_ref_id:BC069511
RefSeq ORF Size:1872bp
cDNA Description:Full length Clone DNA of Homo sapiens ubiquitin associated and SH3 domain containing, A.
Gene Synonym:CLIP4, STS-2, TULA, TULA-1, UBASH3A
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

UBASH3A is a member of the T-cell ubiquitin ligand (TULA) family. This family consists of two members. Both of them can negatively regulate T-cell signaling. UBASH3A can facilitate growth factor withdrawal-induced apoptosis in T cells, which may occur via its interaction with AIF, an apoptosis-inducing factor. Alternative splicing of UBASH3A gene results in multiple transcript variants. It interferes with CBL-mediated down-regulation and degradation of receptor-type tyrosine kinases. UBASH3A promotes accumulation of activated target receptors, such as T-cell receptors, EGFR and PDGFRB, on the cell surface. UBASH3A also exhibits negligigle protein tyrosine phosphatase activity at neutral pH. It may act as a dominant-negative regulator of UBASH3B-dependent dephosphorylation. It may also inhibit dynamin-dependent endocytic pathways by functionally sequestering dynamin via its SH3 domain.

References
  • Collingwood TS, et al. (2007) T-cell ubiquitin ligand affects cell death through a functional interaction with apoptosis-inducing factor, a key factor of caspase-independent apoptosis.". J. Biol. Chem. 282 (42): 30920-8.
  • Smirnova EV, et al. (2008) TULA proteins bind to ABCE-1, a host factor of HIV-1 assembly, and inhibit HIV-1 biogenesis in a UBA-dependent fashion. Virology. 372(1):10-23.
  • Wattenhofer M, et al. (2001) Isolation and characterization of the UBASH3A gene on 21q22.3 encoding a potential nuclear protein with a novel combination of domains. Hum Genet. 108(2):140-7.
  • Size / Price
    Catalog: HG13847-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"