Quick Order

Human NR2C2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NR2C2 cDNA Clone Product Information
Gene_bank_ref_id:BC051670
RefSeq ORF Size:1593bp
cDNA Description:Full length Clone DNA of Homo sapiens nuclear receptor subfamily 2, group C, member 2.
Gene Synonym:TAK1, TR2R1, TR4, hTAK1, NR2C2
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-NR2C2
Restriction Site:KpnI + XbaI (6.1kb + 1.59kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG13824-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"