Quick Order

Human LMAN2L Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LMAN2LcDNA Clone Product Information
Gene_bank_ref_id:BC067265
cDNA Size:1047
cDNA Description:ORF Clone of Homo sapiens lectin, mannose-binding 2-like DNA.
Gene Synonym:PSEC0028, DKFZp564L2423, MGC11139, VIPL, LMAN2L
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

LMAN2L contains 1 L-type lectin-like domain and is expressed in numerous tissues. It is highly expressed in skeletal muscle and kidney, and its intermediate expression levels in heart, liver and placenta, low levels in brain, thymus, spleen, small intestine and lung. LMAN2L may be involved in the regulation of export from the endoplasmic reticulum of a subset of glycoproteins. It also may function as a regulator of ERGIC-53. LMAN2L gene may be modulated by acetylation; phosphorylation, as detailed at PhosphoSite. Alternative splicing produces 2 isoforms of the human protein. LMAN2L localize in various compartments.

References
  • Hartley JL, et al. (2001) DNA cloning using in vitro site-specific recombination. Genome Res. 10 (11):1788-95.
  • Suzuki Y, et al. (1997) Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library. Gene. 200(1-2):149-56.
  • Maruyama K, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138(1-2):171-4.
  • Size / Price
    Catalog:HG13822-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"