After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human BCL2L11 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human BCL2L11 cDNA Clone Product Information
Gene_bank_ref_id:BC033694
RefSeq ORF Size:597bp
cDNA Description:Full length Clone DNA of Homo sapiens BCL2-like 11 (apoptosis facilitator).
Gene Synonym:BAM, BIM, BIM-alpha6, BIM-beta6, BIM-beta7, BOD, BimEL, BimL, BCL2L11
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

BCL2L11, also known as Bim, belongs to the BCL-2 protein family. Members of this family form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. BCL2L11 contains a Bcl-2 homology domain 3 (BH3). It has been shown to interact with other members of the BCL-2 protein family, including BCL2, BCL2L1/BCL-X(L), and MCL1, and to act as an apoptotic activator. BCL2L11 gene functions as an essential initiator of apoptosis in thymocyte-negative selection.

References
  • Day Catherine L. et al., 2004, Biochem J. 377 (3): 597-605.
  • Murray S. et al., 2001, Cytogenet Cell Genet. 92 (3-4): 353.
  • Hsu SY. et al., 1998,Mol Endocrinol. 12 (9): 1432-40.
  • Size / Price
    Catalog: HG13816-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"