Quick Order

Text Size:AAA

Human PPTC7 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PPTC7 cDNA Clone Product Information
NCBI RefSeq:NM_139283.1
RefSeq ORF Size:915bp
cDNA Description:Full length Clone DNA of Homo sapiens PTC7 protein phosphatase homolog (S. cerevisiae).
Gene Synonym:TAPP2C, TA-PP2C, PPTC7
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PPTC7
Restriction Site:KpnI + XbaI (6.1kb + 0.92kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PPTC7 Gene Plasmid Map
Human PPTC7 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: HG13800-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"