Quick Order

Text Size:AAA

Human UBE4B transcript variant 2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human UBE4B cDNA Clone Product Information
Gene_bank_ref_id:NM_006048.4
RefSeq ORF Size:3522bp
cDNA Description:Full length Clone DNA of Homo sapiens ubiquitination factor E4B, transcript variant 2.
Gene Synonym:E4, UFD2, HDNB1, UBOX3, UFD2A, UBE4B
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"