Quick Order

Text Size:AAA

Human NCR1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NCR1cDNA Clone Product Information
cDNA Size:912
cDNA Description:ORF Clone of Homo sapiens natural cytotoxicity triggering receptor 1 DNA.
Gene Synonym:XXbac-BCX195L8.10-004, CD335, FLJ99094, LY94, NK-p46, NKP46, NCR1
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

NCR1, also known as NK-p46 and CD335, is a natural cytotoxicity receptor(NCR). NCRs are type I transmembrane proteins with 1-2 extracellular immunoglobulin domains, a transmembrane domain containing a positively charged amino acid residue, and a short cytoplasmic tail. All are expressed almost exclusively by NK cells and play a major role in triggering NK-mediated killing of most tumor cell lines. NKp46 has two extracellular Ig-like domains followed by a ~40 residue stalk region, a type I transmembrane domain, and a short cytoplasmic tail. NKp46 has been implicated in NK cell-mediated lysis of several autologous tumor cells, pathogen-infected cell lines and mononuclear phagocytes infected with an intracellular bacterium.

  • Carbone E, et al. (2005) HLA class I, NKG2D, and natural cytotoxicity receptors regulate multiple myeloma cell recognition by natural killer cells. Blood. 105(1):251-8.
  • Sivori S, et al. (1997) p46, a Novel Natural Killer Cell-specific Surface Molecule That Mediates Cell Activation. J Exp Med. 186(7):1129-36.
  • Biassoni R, et al. (2004) Human natural killer cell receptors: insights into their molecular function and structure. J Cell Mol Med. 7(4):376-87.