After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GALNT2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GALNT2 cDNA Clone Product Information
NCBI RefSeq:BC041120
RefSeq ORF Size:1716bp
cDNA Description:Full length Clone DNA of Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2).
Gene Synonym:GalNAc-T2, GALNT2
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

GALNT2, also known as GalNAc-T2, is a member of the GalNAc-transferases family. Members of this family transfer an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. GALNT2 may play a role in lipid metabolism. It catalyzes the initial reaction in O-linked oligosaccharide biosynthesis, the transfer of an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. GALNT2 has a broad spectrum of substrates for peptides such as EA2, Muc5AC, Muc1a, Muc1b.

References
  • Bennett EP. et al., 1998, Glycobiology. 8 (6): 547-55.
  • White T. et al., 1995, J Biol Chem. 270 (41): 24156-65.
  • Bennett EP. et al., 1996, J Biol Chem. 271 (29): 17006-12.
  • Holleboom AG. et al., 2011, Cell Metab. 14 (6): 811-8.
  • Size / Price
    Catalog: HG13764-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"