Quick Order

Human QPCT natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human QPCT cDNA Clone Product Information
Gene_bank_ref_id:BC047756
RefSeq ORF Size:1086bp
cDNA Description:Full length Clone DNA of Homo sapiens glutaminyl-peptide cyclotransferase.
Gene Synonym:GCT, QC, sQC, QPCT
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-QPCT
Restriction Site:HindIII + XbaI (6.1kb + 1.09kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human QPCT Gene Plasmid Map
Human QPCT natural ORF mammalian expression plasmid
Product nameProduct name
Background

Glutaminyl cyclase, also known as QPCT, can promote the N-terminal cyclization reaction of N-terminal pyroglutamate(pGlu). The pGlu formation from its glutaminyl precursor is required in the maturation of numerous bioactive peptides, while the aberrant formation of pGlu may be related to several pathological processes, such as osteoporosis and amyloidotic diseases. Glutaminyl cyclase's structure reveals an alpha/beta scaffold akin to that of two-zinc exopeptidases but with several insertions and deletions, particularly in the active-site region. Glutaminyl cyclase's amino acid sequence of this enzyme is 86% identical to that of bovine glutaminyl cyclase. It is responsible for the presence of pyroglutamyl residues in many neuroendocrine peptides.

References
  • Busby WH, et al. (1987) An enzyme(s) that converts glutaminyl-peptides into pyroglutamyl-peptides. Presence in pituitary, brain, adrenal medulla, and lymphocytes. J Biol Chem. 262(18):8532-6.
  • Bateman RC, et al. (2001) Evidence for essential histidines in human pituitary glutaminyl cyclase. Biochemistry. 40(37):11246-50.
  • Schilling S, et al. (2002) Heterologous expression and characterization of human glutaminyl cyclase: evidence for a disulfide bond with importance for catalytic activity. Biochemistry. 41 (35):10849-57.
  • Size / Price
    Catalog: HG13752-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"