After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TMEM25 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TMEM25 cDNA Clone Product Information
Gene_bank_ref_id:BC051841
RefSeq ORF Size:969bp
cDNA Description:Full length Clone DNA of Homo sapiens transmembrane protein 25.
Gene Synonym:UNQ2531/PRO6030, FLJ14399, TMEM25
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

TMEM25 is a novel member of the immunoglobulin superfamily. Immunoglobulin superfamily members are implicated in immune responses, growth factor signaling, and cell adhesion. TMEM25 contains 1 Ig-like (immunoglobulin-like) domain and is a target of pharmacogenomics in the field of oncology and regenerative medicine. TMEM25 isoform 1, consisting of exons 1-9, encoded a 366-aa transmembrane protein. TMEM25 isoform 2, consisting of exons 1-4 and 6-9, encoded a 322-aa secreted protein. TMEM25 mRNA was expressed in brain, including cerebellar cortex and hippocampus, as well as in neuroblastoma, brain tumors, and gastric cancer. Human TMEM25 gene was located at the 11q23.3 oncogenomic recombination hotspot around the MLL amplicon and the neuroblastoma deleted region.

References
  • Grouse LH, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Suzuki Y, et al. (1997) Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library. Gene. 200(1-2):149-56.
  • Sugano S, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138(1-2):171-4.
  • Katoh M, et al. (2004) Identification and characterization of human TMEM25 and mouse Tmem25 genes in silico. Oncol Rep. 12(2):429-33.
  • Size / Price
    Catalog: HG13750-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"