Quick Order

Text Size:AAA

Human AMIGO2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AMIGO2 cDNA Clone Product Information
Gene_bank_ref_id:BC047595
RefSeq ORF Size:1569bp
cDNA Description:Full length Clone DNA of Homo sapiens adhesion molecule with Ig-like domain 2.
Gene Synonym:ALI1, DEGA, AMIGO2
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

AMIGO2 contains Ig-like C2-type (immunoglobulin-like) domain, 6 LRR (leucine-rich) repeats, 1 LRRCT domain and 1 LRRNT domain. It belongs to the immunoglobulin superfamily, AMIGO family. AMIGO2 may mediate homophilic as well as heterophilic cell-cell interaction with AMIGO1 or AMIGO3. It is required for depolarization-dependent survival of cultured cerebellar granule neurons. AMIGO2 may also contribute to signal transduction through its intracellular domain. It may play a role in the tumorigenesis of a subset of gastric adenocarcinomas. AMIGO2 is highly expressed in breast, ovary, cervix, and uterus.

References
  • Rouhiainen A, et al. (2003) AMIGO, a transmembrane protein implicated in axon tract development, defines a novel protein family with leucine-rich repeats. J Cell Biol. 160:963-73.
  • Kikkawa Y, et al. (2003) Alivin 1, a novel neuronal activity-dependent gene, inhibits apoptosis and promotes survival of cerebellar granule neurons. J Neurosci. 23:5887-96.
  • Bassi R, et al. (2004) DEGA/AMIGO-2, a leucine-rich repeat family member, differentially expressed in human gastric adenocarcinoma: effects on ploidy, chromosomal stability, cell adhesion/migration and tumorigenicity. Oncogene 23:5056-67.
  • Size / Price
    Catalog: HG13735-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"