After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human KDM1A / KDM1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human KDM1A cDNA Clone Product Information
NCBI RefSeq:NM_015013.3
RefSeq ORF Size:2559bp
cDNA Description:Full length Clone DNA of Homo sapiens lysine (K)-specific demethylase 1A.
Gene Synonym:AOF2, KDM1, LSD1, BHC110, KDM1A
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

LSD1 belongs to the flavin monoamine oxidase family. It contains 1 SWIRM domain and is a component of a RCOR/GFI/LSD1/HDAC complex. LSD1 interacts directly with GFI1 and GFI1B. LSD1 speficially removes histone H3K4me2 to H3K4me1 or H3K4me0 through a FAD-dependent oxidative reaction. When forming a complex with androgen receptor (and possibly other nuclear hormone receptors), LSD1 changes its substrates to H3K9me2. Thus LSD1 is considered to act as a coactivator or a corepressor. It may play a role in the repression of neuronal genes. Alone, LSD1 is unable to demethylate H3 'Lys-4' on nucleosomes and requires the presence of RCOR1/CoREST to achieve such activity.

References
  • Kusaba M, et al. (2007) Rice NON-YELLOW COLORING1 is involved in light-harvesting complex II and grana degradation during leaf senescence. Plant Cell. 19(4):1362-75.
  • Pazour GJ, et al. (2005) Proteomic analysis of a eukaryotic cilium. J Cell Biol. 170(1):103-13.
  • Merchant SS, et al. (2007) The Chlamydomonas genome reveals the evolution of key animal and plant functions. Science. 318(5848):245-50.
  • Size / Price
    Catalog: HG13721-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"