Quick Order

Human COL10A1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human COL10A1 cDNA Clone Product Information
Gene_bank_ref_id:NM_000493.3
RefSeq ORF Size:2043bp
cDNA Description:Full length Clone DNA of Homo sapiens collagen, type X, alpha 1.
Gene Synonym:COL10A1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-COL10A1
Restriction Site:KpnI (two restriction sites) + XbaI (6.11kb+1.17kb+0.88kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human COL10A1 Gene Plasmid Map
Human COL10A1 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: HG13679-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"