After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human EPDR1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human EPDR1 cDNA Clone Product Information
Gene_bank_ref_id:BC018299
RefSeq ORF Size:675bp
cDNA Description:Full length Clone DNA of Homo sapiens ependymin related protein 1 (zebrafish).
Gene Synonym:EPDR, UCC1, MERP1, MERP-1, EPDR1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

EPDR1 is a member of the ependymin family. EPDR1 is a type II transmembrane protein that is similar to two families of cell adhesion molecules, the protocadherins and ependymins. It may play a role in calcium-dependent cell adhesion. EPDR1 is glycosylated, and the orthologous mouse protein is localized to the lysosome. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 8.

References
  • Suga T. et al., 2008, Int J Radiat Oncol Biol Phys. 72 (3): 808-13.
  • Rose JE. et al., 2010, Mol Med. 16 (7-8): 247-53.
  • Cheng W. et al., 2010, J Huazhong Univ Sci Technolog Med Sci. 30 (3): 391-6.
  • Size / Price
    Catalog: HG13665-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"