Quick Order

Text Size:AAA

Human GNGT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GNGT1cDNA Clone Product Information
cDNA Size:225
cDNA Description:ORF Clone of Homo sapiens guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1 DNA.
Gene Synonym:GNG1, GNGT1
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

GNGT1 is a subunit of of transducin. Heterotrimeric G proteins consist of alpha, beta, and gamma subunits. They are membrane bound GTPases that are linked to 7-TM receptors. They function as signal transducers for the 7-transmembrane-helix G protein-coupled receptors. They are involved as a modulator or transducer in various transmembrane signaling systems. G proteins are bound to GDP in the 'off' state. GNGT1 is the gamma subunit of transducin. Ligand-receptor binding results in detachment of the G protein, switching it to an 'on' state and permitting Galpha activation of second messenger signalling cascades. There are several types of Galpha proteins; in addition, some Gbetagamma subunits have active functions. Gbetagamma coupled to H1 receptors can activate PLA2 and Gbetagamma coupled to M1 receptors can activate KIR channels. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction.

  • Tao L, et al. (1993) Structure of the bovine transducin gamma subunit gene and analysis of promoter function in transgenic mice. Exp Eye Res. 56 (4): 497-507.
  • Yan K, et al. (1996) Differential ability to form the G protein betagamma complex among members of the beta and gamma subunit families. J Biol Chem. 271 (12): 7141-6.
  • Gaudet R, et al. (1999) A molecular mechanism for the phosphorylation-dependent regulation of heterotrimeric G proteins by phosducin. Mol Cell. 3 (5): 649-60.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items