Quick Order

Human SRGN Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SRGNcDNA Clone Product Information
cDNA Size:477
cDNA Description:ORF Clone of Homo sapiens serglycin DNA.
Gene Synonym:PPG, PRG, PRG1, SRGN
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

SRGN is known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of various hematopoietic cells has a protease-resistant peptide core, and is vital for neutralizing hydrolytic enzymes. SRGN is associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. It is required for storage of some proteases in both connective tissue and mucosal mast cells and for storage of granzyme B in T-lymphocytes. SRGN also plays a role in localizing neutrophil elastase in azurophil granules of neutrophils.

  • Hatton MN. et al., 1985, Biochem J. 230 (3): 817-20.
  • Schick BP. et al., 1995, J Cell Physiol. 165 (1): 96-106.
  • Kato S. et al., 1995, Gene. 150 (2): 243-50.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items