Quick Order

Text Size:AAA

Human DCBLD2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DCBLD2 cDNA Clone Product Information
Gene_bank_ref_id:BC029658
RefSeq ORF Size:2232bp
cDNA Description:Full length Clone DNA of Homo sapiens discoidin, CUB and LCCL domain containing 2.
Gene Synonym:ESDN, CLCP1, DCBLD2
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

DCBLD2, also known as ESDN and CLCP1, localizes in various compartments. DCBLD2 is up-regulated in lung cancers and is regulated by transcription factor AP-2 alpha (TFAP2A), a component of activator protein-2 (AP-2) that is known to regulate IL-8 production in human lung fibroblasts and epithelial cells. DCBLD2 could be related to FEV(1)-related phenotypes in asthmatics. DCBLD2 gene is expressed at very high level. DCBLD2 is proposed to participate in processes such as intracellular receptor mediated signaling pathway, negative regulation of cell growth and so on.

References
  • Kobuke K. et al., 2001, J Biol Chem. 276 (36): 34105-14.
  • Adeghi MM. et al., 2007, Am J Transplant. 7 (9): 2098-105.
  • Chen Y. et al., 2007, Proteomics. 7 (14): 2384-97.
  • Park TJ. et al., 2012, J Korean Med Sci. 27 (4): 343-9.
  • Size / Price
    Catalog: HG13615-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"