Quick Order

Text Size:AAA

Human UNC5B natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human UNC5B cDNA Clone Product Information
Gene_bank_ref_id:NM_170744.4
RefSeq ORF Size:2838bp
cDNA Description:Full length Clone DNA of Homo sapiens unc-5 homolog B (C. elegans).
Gene Synonym:UNC5H2, p53RDL1, UNC5B
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-UNC5B
Restriction Site:HindIII + XbaI (6.1kb + 2.84kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG13606-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"