After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PNLIP natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human PNLIP cDNA Clone Product Information
NCBI RefSeq:BC014309
RefSeq ORF Size:1398bp
cDNA Description:Full length Clone DNA of Homo sapiens pancreatic lipase.
Gene Synonym:PL, PTL, PNLIPD, PNLIP
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

PNLIP is an enzyme which belongs to the lipase family. Secreted from the pancreas, PNLIP is the primary lipase that hydrolyzes dietary fat molecules in the human digestive system, converting triglyceride substrates found in ingested oils to monoglycerides and free fatty acids. Bile salts secreted from the liver and stored in gallbladder are released into the duodenum where they coat and emulsify large fat droplets into smaller droplets, thus increasing the overall surface area of the fat, which allows the lipase to break apart the fat more effectively. The resulting monomers (2 free fatty acids and one 2-monoacylglycerol) are then moved by way of peristalsis along the small intestine to be absorbed into the lymphatic system by a specialized vessel called a lacteal.

References
  • Hegele RA, et al. (2001) Polymorphisms in PNLIP, encoding pancreatic lipase, and associations with metabolic traits. J Hum Genet. 46(6):320-4.
  • Thomas A, et al. (2005) Role of the lid hydrophobicity pattern in pancreatic lipase activity. J Biol Chem. 280(48):40074-83.
  • Colin DY, et al. (2008) Exploring the active site cavity of human pancreatic lipase. Biochem Biophys Res Commun. 370(3):394-8.
  • Size / Price
    Catalog: HG13564-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"