Quick Order

Human ADAMTSL1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ADAMTSL1cDNA Clone Product Information
Gene_bank_ref_id:BC030262
cDNA Size:1320
cDNA Description:ORF Clone of Homo sapiens ADAMTS-like 1 DNA.
Gene Synonym:C9orf94, PUNCTIN, ADAMTSR1, ADAMTSL-1, ADAMTSL1
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

ADAMTSL1 is a secreted molecule resembling members of the ADAMTS protein family of matrix metalloproteinases. Both ADAMTS proteins and ADAM protein family contain a disintegrin and a metalloprotease domain. Metallospondins is collective term for members of ADAMTS protein family. ADAMTS proteins lack the EGF-like domain found normally in members of the ADAM protein family. They also do not possess the canonical disintegrin sequence found in the ADAM protein family. It contains the domains found in members of the ADAMTS protein family with the exception of the pro-metalloprotease and the disintegrin-like domain typical of this family. ADAMTSL1 gene is expressed in adult skeletal muscle. ADAMTSL1 may play an important role in the extracellular matrix as it is deposited in the cell substratum in a punctate fashion and is excluded from focal contacts.

References
  • Hirohata S, et al. (2002) Punctin, a novel ADAMTS-like molecule, ADAMTSL-1, in extracellular matrix. J Biol Chem. 277 (14): 12182-9.
  • Wang LW, et al. (2007) O-fucosylation of thrombospondin type 1 repeats in ADAMTS-like-1/punctin-1 regulates secretion: implications for the ADAMTS superfamily. J Biol Chem. 282 (23): 17024-31.
  • Hall NG, et al. (2004) ADAMTSL-3/punctin-2, a novel glycoprotein in extracellular matrix related to the ADAMTS family of metalloproteases. Matrix Biol. 22 (6): 501-10.
  • Size / Price
    Catalog:HG13550-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"