Quick Order

Human CALR natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CALR cDNA Clone Product Information
Gene_bank_ref_id:BC002500
RefSeq ORF Size:1254bp
cDNA Description:Full length Clone DNA of Homo sapiens calreticulin.
Gene Synonym:RO, CRT, SSA, cC1qR, CALR
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Calreticulin is a multifunctional protein. It acts as a main Ca(2+)-binding (storage) protein in the lumen of the endoplasmic reticulum. Calreticulin binds Ca2+ ions (a second messenger in signal transduction), rendering it inactive. The Ca2+ is bound with low affinity, but high capacity, and can be released on a signal. Located in storage compartments associated with the endoplasmic reticulum, calreticulin also binds to misfolded proteins and prevents them from being exported from the endoplasmic reticulum to the golgi apparatus. The amino terminus of calreticulin interacts with the DNA-binding domain of the glucocorticoid receptor and prevents the receptor from binding to its specific glucocorticoid response element. Calreticulin reduces the binding of androgen receptor to its hormone-responsive DNA element and inhibits androgen receptor and retinoic acid receptor transcriptional activities in vivo, as well as retinoic acid-induced neuronal differentiation. Therefore, calreticulin acts as a significant modulator of the regulation of gene transcription by nuclear hormone receptors.

References
  • Michalak M, et al. (2002) Calreticulin in cardiac development and pathology. Biochim Biophys Acta. 1600(1-2):32-7.
  • Chao MP, et al. (2010) Calreticulin is the dominant pro-phagocytic signal on multiple human cancers and is counterbalanced by CD47. Sci Transl Med. 2(63):63ra94.
  • Andrin, C, et al. (1998) Interaction between a Ca2+-binding protein calreticulin and perforin, a component of the cytotoxic T-cell granules. Biochemistry. 37(29):10386-94.
  • Size / Price
    Catalog: HG13539-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"