Quick Order

Human ANXA2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ANXA2 cDNA Clone Product Information
Gene_bank_ref_id:BC009564
RefSeq ORF Size:1020bp
cDNA Description:Full length Clone DNA of Homo sapiens annexin A2.
Gene Synonym:P36, ANX2, LIP2, LPC2, CAL1H, LPC2D, ANX2L4, PAP-IV, ANXA2
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ANXA2
Restriction Site:KpnI + XbaI (6.1kb + 1.02kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG13517-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"