Quick Order

Text Size:AAA

Human TNKS2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TNKS2 cDNA Clone Product Information
Gene_bank_ref_id:NM_025235.3
RefSeq ORF Size:3501bp
cDNA Description:Full length Clone DNA of Homo sapiens tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2.
Gene Synonym:TNKL, TANK2, pART6, PARP5B, PARP5C, PARP-5b, PARP-5c, TNKS2
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG13513-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"