Quick Order

Human DCX Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DCXcDNA Clone Product Information
cDNA Size:1083
cDNA Description:ORF Clone of Homo sapiens doublecortin DNA.
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

DCX (doublecortin, N-GST chimera)contains 2 doublecortin domains and belongs to the doublecortin family. It is highly expressed in neuronal cells of fetal brain, but not expressed in other fetal tissues. In the adult, it is highly expressed in the brain frontal lobe, but very low expression in other regions of brain, and not detected in heart, placenta, lung, liver, skeletal muscles, kidney and pancreas. DCX is a microtubule-associated protein required for initial steps of neuronal dispersion and cortex lamination during cerebral cortex development. It may act by competing with the putative neuronal protein kinase DCAMKL1 in binding to a target protein. DCX may in that way participate in a signaling pathway that is crucial for neuronal interaction before and during migration, possibly as part of a calcium ion-dependent signal transduction pathway. It may be part with LIS-1 of a overlapping, but distinct, signaling pathways that promote neuronal migration. Defects in DCX are the cause of lissencephaly X-linked type 1 and subcortical band heterotopia X-linked.

  • Des Portes V, et al. (1998) A novel CNS gene required for neuronal migration and involved in X-linked subcortical laminar heterotopia and lissencephaly syndrome. Cell. 92:51-61.
  • Gleeson J G, et al. (998) Doublecortin, a brain-specific gene mutated in human X-linked lissencephaly and double cortex syndrome, encodes a putative signaling protein. Cell. 92:63-72.
  • Ross M T, et al. (2005) The DNA sequence of the human X chromosome. Nature. 434:325-37.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items