Quick Order

Human EDN1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human EDN1 cDNA Clone Product Information
Gene_bank_ref_id:BC009720
RefSeq ORF Size:639bp
cDNA Description:Full length Clone DNA of Homo sapiens endothelin 1.
Gene Synonym:ET1, PPET1, HDLCQ7, EDN1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-EDN1
Restriction Site:KpnI + XbaI (6.1kb + 0.64kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG13459-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"