After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human LYG1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human LYG1 cDNA Clone Product Information
NCBI RefSeq:BC029126
RefSeq ORF Size:585bp
cDNA Description:Full length Clone DNA of Homo sapiens lysozyme G-like 1.
Gene Synonym:SALW1939, LYG1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Lysozyme G-like 1 belongs to the glycosyl hydrolase 23 family. Glycoside hydrolases are a widespread group of enzymes that hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. Lysozyme G-like 1 exhibits hydrolase activity, acting on glycosyl bonds (inferred); lysozyme activity (inferred). It is found in extracellular region and may functions in cell wall macromolecule catabolic process, metabolic process and peptidoglycan catabolic process. The lysozyme G gene structure has been largely conserved during vertebrate evolution, except at the 5' end of the gene, which varies in number of exons.

References
  • EIrwin DM, et al. (2003) Molecular evolution of vertebrate goose-type lysozyme genes. J Mol Evol. 56(2):234-42.
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Sklar P, et al. (2011) Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. Nat Genet. 43(10):977-83.
  • Size / Price
    Catalog: HG13457-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"