After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human FSTL5 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FSTL5 cDNA Clone Product Information
Gene_bank_ref_id:NM_020116.3
RefSeq ORF Size:2544bp
cDNA Description:Full length Clone DNA of Homo sapiens follistatin-like 5.
Gene Synonym:FSTL5
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-FSTL5
Restriction Site:KpnI(two restriction sites) + XbaI (6.1kb + 1.69kb + 0.86kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

FSTL5 may have molecular function (calcium ion binding) and to localize in various compartments (cytoplasm, extracellular space, extracellular region). FSTL5 expression denoted a dismal prognosis both within and across medulloblastoma subgroups. FSTL5 gene is well expressed, 1.0 times the average gene in this release. The sequence of this gene is defined by 120 GenBank accessions from 113 cDNA clones, some from brain, cerebellum, eye, melanotic melanoma, skin, amygdala, breast and 24 other tissues. FSTL5 gene contains 27 distinct introns. The addition of FSTL5 immunohistochemistry to existing molecular stratification schemes constitutes a reliable and cost-effective tool for prognostication in future clinical trials of medulloblastoma.

References
  • Masuda T, et al. (2009) Laser capture microdissection and cDNA array analysis for identification of mouse KIAA/FLJ genes differentially expressed in the embryonic dorsal spinal cord. Brain Res. 1249:61-7.
  • Kingwell K. (2011) FSTL5--a new prognostic biomarker for medulloblastoma. Nat Rev Neurol. 7(11):598.
  • Remke M, et al. (2011) FSTL5 is a marker of poor prognosis in non-WNT/non-SHH medulloblastoma. J Clin Oncol. 29(29):3852-61.
  • Size / Price
    Catalog: HG13408-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"