Quick Order

Text Size:AAA

Human BST2 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human BST2 cDNA Clone Product Information
NCBI RefSeq:BC033873
RefSeq ORF Size:543bp
cDNA Description:Full length Clone DNA of Homo sapiens bone marrow stromal cell antigen 2.
Gene Synonym:CD317, TETHERIN, BST2
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Ishikawa J, et al. (1995) Molecular cloning and chromosomal mapping of a bone marrow stromal cell surface gene, BST2, that may be involved in pre-B-cell growth. Genomics. 26 (3): 527-34.
  • Viswanathan K, et al. (2011) BST2/Tetherin enhances entry of human cytomegalovirus. PLoS Pathog. 7(11):e1002332.
  • Gifford RJ. (2011) No trespassing: ancient BST2 deletion confers protection against simian immunodeficiency virus infection of humans. Hum Mutat. 32(11).
  • Size / Price
    Catalog: HG13370-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"