After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PHYH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PHYHcDNA Clone Product Information
cDNA Size:1017
cDNA Description:ORF Clone of Homo sapiens phytanoyl-CoA 2-hydroxylase DNA.
Gene Synonym:RD, LN1, PAHX, LNAP1, PHYH1, PHYH
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

PHYH belongs to the family of iron(II)-dependent oxygenases, which typically incorporate one atom of dioxygen into the substrate and one atom into the succinate carboxylate group. PHYH is expressed in liver, kidney, and T-cells, but not in spleen, brain, heart, lung and skeletal muscle. It converts phytanoyl-CoA to 2-hydroxyphytanoyl-CoA. Defects in PHYH can cause Refsum disease (RD). RD is an autosomal recessive disorder characterized clinically by a tetrad of abnormalities: retinitis pigmentosa, peripheral neuropathy, cerebellar ataxia, and elevated protein levels in the cerebrospinal fluid (CSF). Patients exhibit accumulation of the branched-chain fatty acid, phytanic acid, in blood and tissues.

  • Mihalik SJ, et al. (1997) Identification of PAHX, a Refsum disease gene. Nat Genet. 17(2): 185-9.
  • McDonough MA, et al. (2005) Structure of human phytanoyl-CoA 2-hydroxylase identifies molecular mechanisms of Refsum disease. J Biol Chem. 280(49):41101-10.
  • Jansen GA, et al. (1998) Characterization of phytanoyl-Coenzyme A hydroxylase in human liver and activity measurements in patients with peroxisomal disorders. Clin Chim Acta. 271 (2):203-11.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items