Quick Order

Text Size:AAA

Human ANTXR1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ANTXR1 cDNA Clone Product Information
Gene_bank_ref_id:BC012074
RefSeq ORF Size:1002bp
cDNA Description:Full length Clone DNA of Homo sapiens anthrax toxin receptor 1.
Gene Synonym:ATR, TEM8, ANTXR1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

ANTXR1 contains 1 VWFA domain and belongs to the ATR family. ATR (Ataxia telangiectasia and Rad3 related) and ATM (Ataxia telangiectasia mutated) are closely related kinases that are activated by DNA damage. They are serine-threonine protein kinases and belongs to the phosphatidylinositol 3' kinase-like kinase (PIKK) family. Upon recruitment by the DNA damage binding proteins/complexes (ATRIP for ATR; MRN for ATM), ATM/ATR initiate the DNA damage checkpoint by phosphorylating a number of key proteins. ANTXR1 interacts with extracellular matrix proteins and with the actin cytoskeleton. It functions in cell attachment and migration. ANTXR1 also mediates adhesion of cells to type 1 collagen and gelatin, reorganization of the actin cytoskeleton and promotes cell spreading. It plays a role in the angiogenic response of cultured umbilical vein endothelial cells.

References
  • Chaudhary A, et al. (2012) TEM8/ANTXR1 blockade inhibits pathological angiogenesis and potentiates tumoricidal responses against multiple cancer types. Cancer Cell. 21 (2): 212-26.
  • Garlick KM, et al. (2012) Binding of filamentous actin to anthrax toxin receptor 1 decreases its association with protective antigen. Biochemistry. 51 (6): 1249-56.
  • St Croix B, et al. (2000) Genes expressed in human tumor endothelium. Science. 289 (5482): 1197-202.
  • Size / Price
    Catalog: HG13367-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"