Quick Order

Text Size:AAA

Human SIAE Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SIAEcDNA Clone Product Information
cDNA Size:1572
cDNA Description:ORF Clone of Homo sapiens sialic acid acetylesterase DNA.
Gene Synonym:LSE, AIS6, CSEC, YSG2, CSE-C, MGC87009, SIAE
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Sialate O-acetylesterase belongs to the family of hydrolases, specifically those acting on carboxylic ester bonds. It is widely expressed with high expression in the testis, prostate, and colon. The systematic name of this enzyme class is N-acyl-O-acetylneuraminate O-acetylhydrolase. Other names in common use include N-acetylneuraminate acetyltransferase, sialate 9(4)-O-acetylesterase, and sialidase. Sialate O-acetylesterase catalyzes the removal of O-acetyl ester groups from position 9 of the parent sialic acid, N-acetylneuraminic acid. Defects in Sialate O-acetylesterase are a cause of autoimmune disease type 6 (AIS6). Individuals manifesting susceptibility to autoimmune disease type 6 can suffer from juvenile idiopathic arthritis, rheumatoid arthritis, multiple sclerosis, Sjogren syndrome, systemic lupus erythematosus, type 1 diabetes, ulcerative colitis, and Crohn disease.

  • Mandal C, et al. (2012) Regulation of O-acetylation of sialic acids by sialate-O-acetyltransferase and sialate-O-acetylesterase activities in childhood acute lymphoblastic leukemia. Glycobiology. 22(1): 70-83.
  • Tsai S, et al. (2011) Transcriptional profiling of human placentas from pregnancies complicated by preeclampsia reveals disregulation of sialic acid acetylesterase and immune signalling pathways. Placenta. 32 (2): 175-82.
  • Surolia I, et al. (2010) Functionally defective germline variants of sialic acid acetylesterase in autoimmunity. Nature. 466 (7303): 243-7.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items