After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human FCER1A natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FCER1A cDNA Clone Product Information
Gene_bank_ref_id:NM_002001.2
RefSeq ORF Size:774bp
cDNA Description:Full length Clone DNA of Homo sapiens Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide.
Gene Synonym:FCE1A, FcERI, FCER1A
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

FcERI, also known as FCER1A, is the alpha subunit of the immunoglobulin epsilon receptor (IgE receptor). IgE receptor is a high affinity IgE receptor which plays a central role in allergic disease, coupling allergen and mast cell to initiate the inflammatory and immediate hypersensitivity responses that are characteristic of disorders such as hay fever and asthma. The allergic response occurs when 2 or more IgE receptors are crosslinked via IgE molecules that in turn are bound to an allergen (antigen) molecule. A perturbation occurs that brings about the release of histamine and proteases from the granules in the cytoplasm of the mast cell and leads to the synthesis of prostaglandins and leukotrienes--potent effectors of the hypersensitivity response. IgE receptor is comprised of an alpha subunit(FcERI), a beta subunit, and two gamma subunits. FcERI is glycosylated and contains 2 Ig-like (immunoglobulin-like) domains.

References
  • Shikanai T, et al. (2002) Sequence variants in the FcepsilonRI alpha chain gene. J Appl Physiol. 93(1):37-41.
  • Sada K, et al. (2002) Regulation of FcepsilonRI-mediated degranulation by an adaptor protein 3BP2 in rat basophilic leukemia RBL-2H3 cells. Blood. 100(6):2138-44.
  • Takahashi K, et al. (2003) Transcriptional regulation of the human high affinity IgE receptor alpha-chain gene. Mol Immunol. 38(16-18):1193-9.
  • Size / Price
    Catalog: HG13193-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"